Sequence retrieval

Genome: Streptococcus gallolyticus subsp. gallolyticus ATCC BAA-2069
Start position: 2263642
End position: 2263665
Length: 24

DNA sequence
>NC_015215, from 2263642 to 2263665 (24 bp); Streptococcus gallolyticus subsp. gallolyticus ATCC BAA-2069 CAAGACCAAGTCCAAAACCAAAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2263293-2264570	Sequence	SGGBAA2069_c22070 rdgA1 HTH-type transcriptional regulator (Protein is coded in complementary strand; from 2264570 to 2263293)