Sequence retrieval

Genome: Streptococcus gallolyticus subsp. gallolyticus ATCC BAA-2069
Start position: 1489125
End position: 1489151
Length: 27

DNA sequence
>NC_015215, from 1489125 to 1489151 (27 bp); Streptococcus gallolyticus subsp. gallolyticus ATCC BAA-2069 ACCACGTCCACCACGTCCACCACGTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1488193-1489506	Sequence	SGGBAA2069_c14310 obgE GTP-binding protein, GTP1/Obg family (Protein is coded in complementary strand; from 1489506 to 1488193)