Sequence retrieval

Genome: Streptococcus gallolyticus subsp. gallolyticus ATCC BAA-2069
Start position: 1484072
End position: 1484095
Length: 24

DNA sequence
>NC_015215, from 1484072 to 1484095 (24 bp); Streptococcus gallolyticus subsp. gallolyticus ATCC BAA-2069 AGTTCAAGTTCAAGCTCAAGTTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1482540-1484777	Sequence	SGGBAA2069_c14260 glnH amino acid ABC transporter amino acid-binding/permease