Sequence retrieval

Genome: Spirochaeta sp. Buddy
Start position: 3055149
End position: 3055202
Length: 54

DNA sequence
>NC_015152, from 3055149 to 3055202 (54 bp); Spirochaeta sp. Buddy GCATCATCCAGCTCTTCTGCATCATCCAGCTCTTCTGCATCATCCAGCTCTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3055059-3056954	Sequence	SpiBuddy_2816 - hypothetical protein (Protein is coded in complementary strand; from 3056954 to 3055059)