Sequence retrieval

Genome: Spirochaeta sp. Buddy
Start position: 2704675
End position: 2704710
Length: 36

DNA sequence
>NC_015152, from 2704675 to 2704710 (36 bp); Spirochaeta sp. Buddy TCTGCATATTTATCTGCATATTTATCTGCATATTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 2703252-2704706	Sequence	SpiBuddy_2490 - carbohydrate kinase (Protein is coded in complementary strand; from 2704706 to 2703252)