Sequence retrieval

Genome: Spirochaeta sp. Buddy
Start position: 2103177
End position: 2103200
Length: 24

DNA sequence
>NC_015152, from 2103177 to 2103200 (24 bp); Spirochaeta sp. Buddy CGGGAGCAGGAGCCGGAGCGGGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2101625-2104387	Sequence	SpiBuddy_1928 - 5'-nucleotidase (Protein is coded in complementary strand; from 2104387 to 2101625)