Sequence retrieval

Genome: Spirochaeta sp. Buddy
Start position: 1990121
End position: 1990150
Length: 30

DNA sequence
>NC_015152, from 1990121 to 1990150 (30 bp); Spirochaeta sp. Buddy TCGTGGTCATGGTCGTGATCGTGGTCGTGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1989512-1992751	Sequence	SpiBuddy_1818 - selenate reductase YgfK (Protein is coded in complementary strand; from 1992751 to 1989512)