Sequence retrieval

Genome: Spirochaeta sp. Buddy
Start position: 1505643
End position: 1505667
Length: 25

DNA sequence
>NC_015152, from 1505643 to 1505667 (25 bp); Spirochaeta sp. Buddy AAAAAAATAAAAAAGAAGAAAAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1504482-1505744	Sequence	SpiBuddy_1388 - YjgP/YjgQ family permease (Protein is coded in complementary strand; from 1505744 to 1504482)