Sequence retrieval

Genome: Spirochaeta sp. Buddy
Start position: 1306936
End position: 1306959
Length: 24

DNA sequence
>NC_015152, from 1306936 to 1306959 (24 bp); Spirochaeta sp. Buddy GTCCTCTTCCTCGCCCTCTTCCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1306901-1307791	Sequence	SpiBuddy_1218 - 30S ribosomal protein S2 (Protein is coded in complementary strand; from 1307791 to 1306901)