Sequence retrieval

Genome: Vulcanisaeta moutnovskia 768-28
Start position: 909751
End position: 909774
Length: 24

DNA sequence
>NC_015151, from 909751 to 909774 (24 bp); Vulcanisaeta moutnovskia 768-28 CAATACCAATAAAAATACCAGTAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 909247-910701	Sequence	VMUT_0947 - FAD-dependent pyridine nucleotide-disulfide oxidoreductase