Sequence retrieval

Genome: Vulcanisaeta moutnovskia 768-28
Start position: 831442
End position: 831465
Length: 24

DNA sequence
>NC_015151, from 831442 to 831465 (24 bp); Vulcanisaeta moutnovskia 768-28 CCTAACCCTAGCCCTAACCCAAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 831119-831499	Sequence	VMUT_0866 - hypothetical protein (Protein is coded in complementary strand; from 831499 to 831119)