Sequence retrieval

Genome: Vulcanisaeta moutnovskia 768-28
Start position: 730321
End position: 730356
Length: 36

DNA sequence
>NC_015151, from 730321 to 730356 (36 bp); Vulcanisaeta moutnovskia 768-28 TTCTCAGCAGCCTTCTCTGCCGCCTTACCAGCAGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 729817-730416	Sequence	VMUT_0760 - 30S ribosomal protein S19 (Protein is coded in complementary strand; from 730416 to 729817)