Sequence retrieval

Genome: Vulcanisaeta moutnovskia 768-28
Start position: 546045
End position: 546068
Length: 24

DNA sequence
>NC_015151, from 546045 to 546068 (24 bp); Vulcanisaeta moutnovskia 768-28 GCTCAGGCTCCGGCTCATTCTCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 545822-546229	Sequence	VMUT_0574 - twin-arginine translocation protein, TatA/E family subunit (Protein is coded in complementary strand; from 546229 to 545822)