Sequence retrieval

Genome: Vulcanisaeta moutnovskia 768-28
Start position: 443637
End position: 443660
Length: 24

DNA sequence
>NC_015151, from 443637 to 443660 (24 bp); Vulcanisaeta moutnovskia 768-28 GGCGGTGGAGGTGGCGGTGGAGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 443529-446186	Sequence	VMUT_0458 - solute binding protein-like protein (Protein is coded in complementary strand; from 446186 to 443529)