Sequence retrieval

Genome: Vulcanisaeta moutnovskia 768-28
Start position: 1957607
End position: 1957630
Length: 24

DNA sequence
>NC_015151, from 1957607 to 1957630 (24 bp); Vulcanisaeta moutnovskia 768-28 TATGATTATTATTAAGATTACGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1957464-1957685	Sequence	VMUT_1994 - hypothetical protein (Protein is coded in complementary strand; from 1957685 to 1957464)