Sequence retrieval

Genome: Vulcanisaeta moutnovskia 768-28
Start position: 171939
End position: 171962
Length: 24

DNA sequence
>NC_015151, from 171939 to 171962 (24 bp); Vulcanisaeta moutnovskia 768-28 CCTGGTACTGGTTCTGGTGCTGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 171669-172733	Sequence	VMUT_0173 - FAD-dependent pyridine nucleotide-disulfide oxidoreductase (Protein is coded in complementary strand; from 172733 to 171669)