Sequence retrieval

Genome: Vulcanisaeta moutnovskia 768-28
Start position: 1363049
End position: 1363072
Length: 24

DNA sequence
>NC_015151, from 1363049 to 1363072 (24 bp); Vulcanisaeta moutnovskia 768-28 CATTAACCTTAACATCAACATTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1362799-1363179	Sequence	VMUT_1380 - beta-lactamase (Protein is coded in complementary strand; from 1363179 to 1362799)