Sequence retrieval

Genome: Vulcanisaeta moutnovskia 768-28
Start position: 1275377
End position: 1275400
Length: 24

DNA sequence
>NC_015151, from 1275377 to 1275400 (24 bp); Vulcanisaeta moutnovskia 768-28 ATTAATATTACTATTAATATTATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1275362-1277134	Sequence	VMUT_1297 - hypothetical protein (Protein is coded in complementary strand; from 1277134 to 1275362)