Sequence retrieval

Genome: Vulcanisaeta moutnovskia 768-28
Start position: 1135133
End position: 1135156
Length: 24

DNA sequence
>NC_015151, from 1135133 to 1135156 (24 bp); Vulcanisaeta moutnovskia 768-28 TTAAGGTTATGGGTAAGGTTGAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1134428-1135276	Sequence	VMUT_1164 - Selenocysteine-specific translation elongation factor-like protein