Sequence retrieval

Genome: Arthrobacter phenanthrenivorans Sphe3
Start position: 956754
End position: 956798
Length: 45

DNA sequence
>NC_015145, from 956754 to 956798 (45 bp); Arthrobacter phenanthrenivorans Sphe3 GGTGCGGCCTGAACCTGGGCGGCCTGGACCGGTGCGGCCTGGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 956535-957197	Sequence	Asphe3_09160 - transglycosylase (Protein is coded in complementary strand; from 957197 to 956535)