Sequence retrieval

Genome: Arthrobacter phenanthrenivorans Sphe3
Start position: 942227
End position: 942271
Length: 45

DNA sequence
>NC_015145, from 942227 to 942271 (45 bp); Arthrobacter phenanthrenivorans Sphe3 TTTCCTGCGGATCACCTTCCTGCGGCTCTCCTTCCTGCGGATCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 942016-942318	Sequence	Asphe3_09010 - hypothetical protein (Protein is coded in complementary strand; from 942318 to 942016)