Sequence retrieval

Genome: Arthrobacter phenanthrenivorans Sphe3
Start position: 919382
End position: 919426
Length: 45

DNA sequence
>NC_015145, from 919382 to 919426 (45 bp); Arthrobacter phenanthrenivorans Sphe3 ATCCCCCTTGCCGCTGTTCCCCGTGCCGCTGTTCCCCGTGCCGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 918472-919452	Sequence	Asphe3_08800 - hypothetical protein (Protein is coded in complementary strand; from 919452 to 918472)