Sequence retrieval

Genome: Arthrobacter phenanthrenivorans Sphe3
Start position: 733224
End position: 733247
Length: 24

DNA sequence
>NC_015145, from 733224 to 733247 (24 bp); Arthrobacter phenanthrenivorans Sphe3 CGGGCGCGGGCTCGGGAGCGGGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 732905-733606	Sequence	Asphe3_07090 - hypothetical protein (Protein is coded in complementary strand; from 733606 to 732905)