Sequence retrieval

Genome: Arthrobacter phenanthrenivorans Sphe3
Start position: 629608
End position: 629631
Length: 24

DNA sequence
>NC_015145, from 629608 to 629631 (24 bp); Arthrobacter phenanthrenivorans Sphe3 CGACAAGGACAAGGACAAGGACAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 628245-629651	Sequence	Asphe3_06130 - arabinose efflux permease family protein