Sequence retrieval

Genome: Arthrobacter phenanthrenivorans Sphe3
Start position: 521151
End position: 521174
Length: 24

DNA sequence
>NC_015145, from 521151 to 521174 (24 bp); Arthrobacter phenanthrenivorans Sphe3 GTGCGGGTGCCGGAGCGGGTGCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 520682-522091	Sequence	Asphe3_04990 - cell wall-associated hydrolase, invasion-associated protein (Protein is coded in complementary strand; from 522091 to 520682)