Sequence retrieval

Genome: Arthrobacter phenanthrenivorans Sphe3
Start position: 462354
End position: 462380
Length: 27

DNA sequence
>NC_015145, from 462354 to 462380 (27 bp); Arthrobacter phenanthrenivorans Sphe3 GGTCCCGCTTGTCCCGCTTGTCCCGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 461650-463002	Sequence	Asphe3_04360 - Major Facilitator Superfamily transporter (Protein is coded in complementary strand; from 463002 to 461650)