Sequence retrieval

Genome: Arthrobacter phenanthrenivorans Sphe3
Start position: 4081465
End position: 4081488
Length: 24

DNA sequence
>NC_015145, from 4081465 to 4081488 (24 bp); Arthrobacter phenanthrenivorans Sphe3 GCACCTGCGCCTGCGCCTGCGCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4080583-4082646	Sequence	Asphe3_38290 - PTS system mannitol-specific transporter subunit IIC (Protein is coded in complementary strand; from 4082646 to 4080583)