Sequence retrieval

Genome: Arthrobacter phenanthrenivorans Sphe3
Start position: 4045524
End position: 4045574
Length: 51

DNA sequence
>NC_015145, from 4045524 to 4045574 (51 bp); Arthrobacter phenanthrenivorans Sphe3 CCGCTCCCCTGACTTTGCGGCTCCGCTCACTTTGCCGCTCCGTTCACTTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 4045568-4046071	Sequence	Asphe3_37950 - hypothetical protein (Protein is coded in complementary strand; from 4046071 to 4045568)