Sequence retrieval

Genome: Arthrobacter phenanthrenivorans Sphe3
Start position: 3830758
End position: 3830781
Length: 24

DNA sequence
>NC_015145, from 3830758 to 3830781 (24 bp); Arthrobacter phenanthrenivorans Sphe3 CCACCGCCACGGCCACGGCCACCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3830658-3831506	Sequence	Asphe3_36000 - NifC-like ABC-type porter/molybdate ABC transporter permease (Protein is coded in complementary strand; from 3831506 to 3830658)