Sequence retrieval

Genome: Arthrobacter phenanthrenivorans Sphe3
Start position: 3818935
End position: 3818958
Length: 24

DNA sequence
>NC_015145, from 3818935 to 3818958 (24 bp); Arthrobacter phenanthrenivorans Sphe3 CCGCCGACGCCGCCGACGCCGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3817963-3819111	Sequence	Asphe3_35900 - phosphoribosylformylglycinamidine cyclo-ligase