Sequence retrieval

Genome: Arthrobacter phenanthrenivorans Sphe3
Start position: 3703236
End position: 3703259
Length: 24

DNA sequence
>NC_015145, from 3703236 to 3703259 (24 bp); Arthrobacter phenanthrenivorans Sphe3 GGGGAGGGGGAGGGAGAGGGGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3702222-3703298	Sequence	Asphe3_34790 - monosaccharide ABC transporter membrane protein, CUT2 family (Protein is coded in complementary strand; from 3703298 to 3702222)