Sequence retrieval

Genome: Arthrobacter phenanthrenivorans Sphe3
Start position: 3514484
End position: 3514507
Length: 24

DNA sequence
>NC_015145, from 3514484 to 3514507 (24 bp); Arthrobacter phenanthrenivorans Sphe3 GGCCCTGGCCCTGGGCCTGGCACT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3514171-3515112	Sequence	Asphe3_33070 - carbohydrate ABC transporter membrane protein 1, CUT1 family