Sequence retrieval

Genome: Arthrobacter phenanthrenivorans Sphe3
Start position: 343837
End position: 343860
Length: 24

DNA sequence
>NC_015145, from 343837 to 343860 (24 bp); Arthrobacter phenanthrenivorans Sphe3 CGAGATCGAGATCGGGATCGGGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 343209-344210	Sequence	Asphe3_03230 - dihydroxyacetone kinase DhaK subunit