Sequence retrieval

Genome: Arthrobacter phenanthrenivorans Sphe3
Start position: 3408506
End position: 3408550
Length: 45

DNA sequence
>NC_015145, from 3408506 to 3408550 (45 bp); Arthrobacter phenanthrenivorans Sphe3 CCGCAGCCTTCTCCCCCGCCGCTTTCTCCCCGGCGGCCTTCCCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3408055-3410166	Sequence	Asphe3_32160 - molecular chaperone (Protein is coded in complementary strand; from 3410166 to 3408055)