Sequence retrieval

Genome: Arthrobacter phenanthrenivorans Sphe3
Start position: 3405204
End position: 3405239
Length: 36

DNA sequence
>NC_015145, from 3405204 to 3405239 (36 bp); Arthrobacter phenanthrenivorans Sphe3 ATGGAGTTGTCCGTGGAGTTATCCGTGGAGTTGTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3404658-3405809	Sequence	Asphe3_32140 - hypothetical protein (Protein is coded in complementary strand; from 3405809 to 3404658)