Sequence retrieval

Genome: Arthrobacter phenanthrenivorans Sphe3
Start position: 3346475
End position: 3346498
Length: 24

DNA sequence
>NC_015145, from 3346475 to 3346498 (24 bp); Arthrobacter phenanthrenivorans Sphe3 TGCTGGCGCTGGCGCTGGTGGTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3346442-3347473	Sequence	Asphe3_31600 - cell envelope-related function transcriptional attenuator common domain-containing protein