Sequence retrieval

Genome: Arthrobacter phenanthrenivorans Sphe3
Start position: 3200013
End position: 3200057
Length: 45

DNA sequence
>NC_015145, from 3200013 to 3200057 (45 bp); Arthrobacter phenanthrenivorans Sphe3 CGGACGCGGGGCCAATGAACTCGGGGCCAACGGACACCGGGGCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3197982-3200186	Sequence	Asphe3_30140 - peptidoglycan binding protein