Sequence retrieval

Genome: Arthrobacter phenanthrenivorans Sphe3
Start position: 3196929
End position: 3196952
Length: 24

DNA sequence
>NC_015145, from 3196929 to 3196952 (24 bp); Arthrobacter phenanthrenivorans Sphe3 GCAGCAGCACCAGCAGGAGCAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3196238-3197407	Sequence	Asphe3_30120 - acyltransferase (Protein is coded in complementary strand; from 3197407 to 3196238)