Sequence retrieval

Genome: Arthrobacter phenanthrenivorans Sphe3
Start position: 3166342
End position: 3166365
Length: 24

DNA sequence
>NC_015145, from 3166342 to 3166365 (24 bp); Arthrobacter phenanthrenivorans Sphe3 GGGGCGGCGGCGTGGGCGGGAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3166282-3167136	Sequence	Asphe3_29770 - glutamine amidotransferase (Protein is coded in complementary strand; from 3167136 to 3166282)