Sequence retrieval

Genome: Arthrobacter phenanthrenivorans Sphe3
Start position: 298607
End position: 298666
Length: 60

DNA sequence
>NC_015145, from 298607 to 298666 (60 bp); Arthrobacter phenanthrenivorans Sphe3 GCAGGCGGGGACAGTTCAGGCCGGGACACTTCAGGCGGGGACAAGTCAGGCGGCGACACT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 297687-299246	Sequence	Asphe3_02840 - D-alanyl-D-alanine carboxypeptidase