Sequence retrieval

Genome: Arthrobacter phenanthrenivorans Sphe3
Start position: 2983548
End position: 2983574
Length: 27

DNA sequence
>NC_015145, from 2983548 to 2983574 (27 bp); Arthrobacter phenanthrenivorans Sphe3 GCCGTCACGGCCGCCACGGCCGCCACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2983012-2983740	Sequence	Asphe3_27970 - 30S ribosomal protein S5 (Protein is coded in complementary strand; from 2983740 to 2983012)