Sequence retrieval

Genome: Arthrobacter phenanthrenivorans Sphe3
Start position: 28431
End position: 28454
Length: 24

DNA sequence
>NC_015145, from 28431 to 28454 (24 bp); Arthrobacter phenanthrenivorans Sphe3 GTCCTTGTCCTTGTCCTTGTCCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 27625-29259	Sequence	Asphe3_00270 - serine/threonine protein phosphatase (Protein is coded in complementary strand; from 29259 to 27625)