Sequence retrieval

Genome: Arthrobacter phenanthrenivorans Sphe3
Start position: 2776136
End position: 2776180
Length: 45

DNA sequence
>NC_015145, from 2776136 to 2776180 (45 bp); Arthrobacter phenanthrenivorans Sphe3 CCTGGTTCTGGTGGGCCTGGTTCTGGTGGGCCTGGTTCTGGTGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2774833-2776449	Sequence	Asphe3_26040 - trypsin-like serine protease with C-terminal PDZ domain (Protein is coded in complementary strand; from 2776449 to 2774833)