Sequence retrieval

Genome: Arthrobacter phenanthrenivorans Sphe3
Start position: 2688062
End position: 2688106
Length: 45

DNA sequence
>NC_015145, from 2688062 to 2688106 (45 bp); Arthrobacter phenanthrenivorans Sphe3 GCAGCTGCGGCAGCCGCGGCTGCGGCAGCTGCTGCAGCCGCAGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2687567-2689015	Sequence	Asphe3_25320 - metalloendopeptidase-like membrane protein (Protein is coded in complementary strand; from 2689015 to 2687567)