Sequence retrieval

Genome: Arthrobacter phenanthrenivorans Sphe3
Start position: 2616077
End position: 2616136
Length: 60

DNA sequence
>NC_015145, from 2616077 to 2616136 (60 bp); Arthrobacter phenanthrenivorans Sphe3 GGCTTCATTGTCCCGGGCTTGATTTTCCTGGGCGGCATCGTCCCGGACTTCATTGTTCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2615835-2618426	Sequence	Asphe3_24640 - hypothetical protein (Protein is coded in complementary strand; from 2618426 to 2615835)