Sequence retrieval

Genome: Arthrobacter phenanthrenivorans Sphe3
Start position: 2411369
End position: 2411392
Length: 24

DNA sequence
>NC_015145, from 2411369 to 2411392 (24 bp); Arthrobacter phenanthrenivorans Sphe3 GCTGCCGGTGCCGCTGCCTCTGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2408225-2411818	Sequence	Asphe3_22680 - ribonuclease, Rne/Rng family (Protein is coded in complementary strand; from 2411818 to 2408225)