Sequence retrieval

Genome: Arthrobacter phenanthrenivorans Sphe3
Start position: 2405303
End position: 2405329
Length: 27

DNA sequence
>NC_015145, from 2405303 to 2405329 (27 bp); Arthrobacter phenanthrenivorans Sphe3 CCGCCGTTGCCGCCGTTGCCGCCGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2403845-2405434	Sequence	Asphe3_22630 - GTP-binding protein Obg/CgtA (Protein is coded in complementary strand; from 2405434 to 2403845)