Sequence retrieval

Genome: Arthrobacter phenanthrenivorans Sphe3
Start position: 2350804
End position: 2350827
Length: 24

DNA sequence
>NC_015145, from 2350804 to 2350827 (24 bp); Arthrobacter phenanthrenivorans Sphe3 GATTGGGTGATCGGGTGATCGGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2350789-2351820	Sequence	Asphe3_22010 - dihydrodipicolinate synthase/N-acetylneuraminate lyase (Protein is coded in complementary strand; from 2351820 to 2350789)