Sequence retrieval

Genome: Arthrobacter phenanthrenivorans Sphe3
Start position: 23408
End position: 23431
Length: 24

DNA sequence
>NC_015145, from 23408 to 23431 (24 bp); Arthrobacter phenanthrenivorans Sphe3 GGGTGGGAGTGGGGGTCGGTGTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 23071-24777	Sequence	Asphe3_00240 - protein kinase family protein (Protein is coded in complementary strand; from 24777 to 23071)