Sequence retrieval

Genome: Arthrobacter phenanthrenivorans Sphe3
Start position: 1751735
End position: 1751758
Length: 24

DNA sequence
>NC_015145, from 1751735 to 1751758 (24 bp); Arthrobacter phenanthrenivorans Sphe3 CCCATGCCCAGGCCCACGCACATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1751633-1752916	Sequence	Asphe3_16280 - acetyl-CoA acetyltransferase (Protein is coded in complementary strand; from 1752916 to 1751633)